Project: AIR_demo_immunization
Pipeline Version: DriverMapAIR_v1.2.0
Cellecta, Inc
Navigation
Below is an overview of the experiment from TCR/BCR nucleotides to reads to clonotypes. Yellow tabs represent information on the pipeline which includes the Cellecta DriverMap Adaptive Immune Receptor (AIR) which provides a description of the DriverMap AIR assay and Bioinformatics Workflow which provides an in-depth description of the computational workflow.
The tabs in green represent the experimental data and data analysis. This includes information on DriveMap Adaptive Immune Receptor TCR/BCR Profiling assay which is described in the Experimental Description tab. This tab contain the details on the sample collection all the way to library generation. The Sequencing & Alignment Quality tab contain details on the initial processing of the sequences and quality of reads and success of read alignment to TCR/BCR genes. The Clonotype Summary tab provides an overview of the identified clonotypes within each sample. The analysis of these clonotypes are further broken down into chains (IGH, IGK, IGL, TRAD, TRB and TRG). For each chain relevant to the experiment, a variety of metrics are calculated provide an overall picture of the repertoire characteristics. This includes repertoire statistics, the top clonotypes, clonotype overlaps between samples, gene usage, gene usage overlaps between samples, diversity metrics and kmer analysis.
DriverMap Adaptive Immune Receptor Repertoire Profiling
The DriverMap Adaptive Immune Receptor (AIR) Repertoire Profiling Service from Cellecta provides you with a profile of all TCR and BCR CDR3 or full-length variable regions in blood, cell, or RNA samples. With the DriverMap AIR TCR-BCR Profiling Service, you get a larger complement of clonotypes than other similar assays, reproducible and comprehensive coverage from a range of immune sample inputs, including total RNA from whole blood and Rapid, 1-month turnaround from sample submission to an extensive analysis report
Since T- and B-cells work synergistically in the adaptive immune response, Cellecta has designed an assay that profiles both T-cell receptor (TCR) and B-cell receptor (BCR) repertoires in a single convenient reaction. Separate assays specific for T- or B-cell chains are also available. The DriverMap AIR-RNA assay quantifies T-cell and B-cell receptor transcripts. It is designed to specifically amplify only functional RNA molecules from human or mouse TCR and BCR cells, avoiding non-functional pseudogenes with similar structures or full-length variable regions from human RNA molecules enables highly sensitive detection of low-frequency, rare TCR and BCR clonotypes and more comprehensive profiling when working with small samples and limited numbers of cells. The DriverMap AIR-DNA assay amplifies receptor genes directly from genomic DNA. The AIR-DNA assay provides a more quantitative measurement of the genetic copies for each CDR3-specific clonotype which correlates to the number of cells with that clonotype in that sample. This data enables the measurement of clonal expansion in T and B cells. Combining data obtained from both the AIR-DNA and AIR-RNA assays enables assessment of both the transcriptional activation and number of cells with a particular clonotype. The ability to differentiate these two effects provides a quantitative basis to assess antigen-activated clonotypes
Applications of BCR sequencing: Identify broadly neutralizing antibodies (BNAbs) and map Ig-seq datasets to known antibody structures for antibody and vaccine development, Track B-cell migration and development patterns, Find markers of autoimmune diseases such as multiple sclerosis, rheumatoid arthritis and cancers (e.g. B-cell lymphoma), and Contrast naïve and antigenically challenged datasets to understand antibody maturation.
Applications of TCR sequencing: Track T-cell clonality and diversity for insights into mechanisms of action of immune checkpoint inhibitors for immunotherapies, Assess TCR overlap between repertoires to define spatial and temporal heterogeneity of the anti-tumoral immune response, and Analyze TCR sequence and structure to annotate antigenic specificity for developing personalized cellular immunotherapies
How is the DriverMap AIR Assay Different from other AIR Assays?
DriverMap™ Multiplex PCR technology uses gene-specific primers which significantly reduce the level of non-specific binding and primer-dimer amplification products, and are designed to target only TCR/BCR isoforms. Unique Molecular Identifiers (UMIs) facilitate accurate quantitation of the copy number of cDNA or DNA molecules in amplification steps, as well as detection of low abundance clonotypes and correction of amplification biases and sequencing errors. Dual-index amplicon labeling strategy minimizes index hopping during NGS allowing for comprehensive readouts. Full profiles of the antigen-recognition CDR3 region enable assessment of CDR3 length distribution, V(D)J segment usage, isotype composition for BCRs, somatic mutations, and similar characteristics with immune receptor profiling software such as MiXCR (MiLabs).
DriverMap Adaptive Imumune Repertoire (AIR) profiling Assay workflow is as follow:
Pipeline
Below is an overview of the bioinformatics analysis pipeline used on DriverMap Adaptive Immune Receptor (AIR) Sequencing data. MiXCR (Bolotin et al., 2015) is used to align the sequencing reads and identify clonotypes and their abundances. The MiXCR Cellecta DNA or RNA Preset is used to perform the read alignment. After alignment, a variety of repetoire metrics can be calculated from the resulting clonotype abundances. This includes repertoire statistics, the top clonotypes, clonotype overlaps between samples, gene usage, gene usage overlaps between samples, diversity metrics and kmer analysis. This is performed mainly using the Immunarch package alongside a variety of R packages for data visualization.
Experimental Details
The details of the library generation is described below. The Protocol section describes the sample collection, the profiling assay, PCR amplification, PCR yields, and primer sequences. The PCR Amplification Results section contains the gel image from the PCR. Sample Description section contains the list of samples in the analysis including relevant metadata.
5-20-24. Repeat of 306 and FC1, Immunization-Rx_Alex Chenchik(AC)> AIR-CDR3 vs AIR-CDR1-2-3 profiling in whole blood.
38 Samples – flow cells (#350) > 300-n paired-end read (high-throughput)> NextSeq500
Sample Description > please find in the attached Excel File
Experiment description: This is fourth experiment (repeat of FC298, 306 and FC1) using reduced starting amount of RNA (25 ng vs old 100ng), reduced cycle numbers for Samples 7 (Im1)>4 cycle less, only immunization 1. Goal is to compare CDR1-2-3 vs CDR3 profiling, as previous data show less variability in controls for CDR1-2-3 profiling (FC1, Dongfang data) .
AIR profiling of Whole Blood RNA samples isolated from AC before and after following treatments:
Immunization 1: PPSV23(pneumococcal polysaccharide)plus Td (tetanus+diphteria) vaccine > 4/27/22
Rx treatment against H.Pilory (clarithromycion+larisolorazole+amoxicillin) > 6/21/22
Immunization 2: Shingrix (against shingles, based on recombinant VZV glycoprotein E antigen herpes zoster virus)> 7/15/22
Before and after each treatment we collected blood in 2 Tempus test tubes (3ml). From Tempus test tubes we purified both total RNA (R-T name in the Sample list) and DNA. Please, note that Tempus and AXgene are two main test tubes used for stabilization/collection of whole blood for RNA/DNA purification.
E.g. for most samples we have duplicates (D1 and D2) for the most time points:
1) 4/1/22 > control before any treatment
2) 4/6/22 > control before any treatment
3) 4/26/22 > control before any treatment
- 4/27/22 > Immunization 1
5) 4/29/22 > 2 days after Im1
6) 5/2/22 > 5 days after Im1
7) 5/5/22 > 8 days after Im1 (T/B cell fraction sorting)
8) 5/12/22 > 15 days after Im1
9) 5/19/22 > 22 days after Im1
10) 6/17/22 > control before Rx
Additional “control” AC whole blood samples (first 3 from Alex Chenchik) collected before:
C_R-T_BP > 3/20/22 (back pain condition)
C1_R-T > 1/12/22
C2_R-T > 1/27/22
Observation and Data quality: Yield of amplified NGS PCR products was +/-2-fold for all samples (e.g. it equal to 16x activation for 7) after appr. one week after Im1t > decided to combine all amplified products in equal amount except sample 7 (4x more) in order to “compensate” loss of reads for activated clonotypes and all CDR1-2-3 will 1.5x more than CDR3 (considering differences in amplicon sizes 500bp vs 350bp). No significant background, smear or primer dimers in any samples.
Protocol:
Step 2- RevGSP binding to mRNA. Total RNA (50ng for WB for all AC samples was incubated with mix of Reverse AIR TCR+BCR GSPs (set10 of 6/23/22, final primer concentration is appr. 10nM of each primer) in 20ul of 1xHyb buffer at 70C, 5 min, 60C for 60 min, cool down to 25C. Hybridized RNA-RevGSP products were purified with 1.2 volume (24 ul) of SPRI beads. The bind to beads RNA-RevGSP hybrid was washed by 2x80% ethanol.
Step 2- Rev GSP extension > cDNA synthesis. The washed magnetic beads were resuspended in 45 ul of 1xRT-Ext buffer, dNTP (0.5 mM), reverse transcriptase (RTscript) and RT hot-start aptamer, collect 41 ul without beads and incubated at 50C for 30 min, and 72C for 10min.
Step 3. Fwd GSP extension. cDNA product (in 40 ul) was splitted for two test tubes and extended by adding 20 ul of master mix with pool of Forward AIR CDR1-2-3 TCR+BCR or AIR CDR3 TCR+BCR GSPs (10 nM final concentration of the each primer)and incubated 98C, 1min, 68C, 10 min and treated with 2 ul of ExoI, 37C, 20min, 95C,5min.
Step 4-1st PCR. FwdGSP-extended cDNA was diluted in PCR master mix (60ul), and anchored cDNA fragments were amplified in 100-ul of Multiplex DNA polymerase reaction mix with universal anchor PCR primers for 19 (most samples) or 15 (sample 7) cycles.
Step 5-2nd PCR. 2ul aliquotes of 1st PCR were added in 96-well plate with 50ul master mix for 2nd PCR step (each well has unique Dual Nextera Index primers) and amplified using unique combination of Nextera Fwd-P5-Index and Rev-P7-Index for 8 cycles, treated with ExoI (1-ul) at 37C for 30min. PCR products were analyzed in Fragment analyzer (see attached file), combined at equal amount, except sample 7 (4x) and all CDR1-2-3 were 1.5x more than CDR3, purified using AMPpure magnetic beads (1.5X volume). The purified cDNA products were quantitated by Qubit fluorescence measurement, and diluted to 10 nM (2.1 ng/ul) for next-generation sequencing using NextSeq500.
Program:
Read1:eSeqDNA-Fwd>148c; Ind1:eSeqIND-Fwd>10c; Ind2:eSeqIND-Rev>10c;Read2: eSeqDNA-Rev>148c.
DriverMap AIR assay Amplicon Structure
eSeqDNA-Fwd
FP5 UDPIndex10 AGCAGCAGCACCGACCAGCAGACA F ACGGCGACCACCGAGATCTACACNNNNNNNNNNAGCAGCAGCACCGACCAGCAGACA-GSP-DNA-
TGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNTCGTCGTCGTGGCTGGTCGTCTGT-GSP-DNA-
TCGTCGTCGTGGCTGGTCGTCTGT
eSeqIND-Rev
eSeqIND-Fwd
UMI14 TCTGTGCTGGTCGGTGCTCGTCGT
-DNA-GSP-NNNNNNNNNNNNNN-TCTGTGCTGGTCGGTGCTCGTCGTNNNNNNNNNNTATCTCGTATGCCGTCTTCTGCT
-DNA-GSP-NNNNNNNNNNNNNN-AGACACGACCAGCCACGAGCAGCANNNNNNNNNNATAGAGCATACGGCAGAAGACGA
R AGACACGACCAGCCACGAGCAGCA UDPIndex10 RP7
eSeqDNA-Rev
| Samples | Sample_Source | Preset | Experiment | Species | Condition |
|---|---|---|---|---|---|
| Control_1 | Control_1 | cellecta-human-rna-xcr-umi-drivermap-air | CDR3 | hsa | Control |
| Control_2 | Control_2 | cellecta-human-rna-xcr-umi-drivermap-air | CDR3 | hsa | Control |
| Control_3 | Control_3 | cellecta-human-rna-xcr-umi-drivermap-air | CDR3 | hsa | Control |
| Immunized_Day5_1 | Immunized_Day5_1 | cellecta-human-rna-xcr-umi-drivermap-air | CDR3 | hsa | PPSV23+Td_Immunized |
| Immunized_Day5_2 | Immunized_Day5_2 | cellecta-human-rna-xcr-umi-drivermap-air | CDR3 | hsa | PPSV23+Td_Immunized |
| Immunized_Day8_1 | Immunized_Day8_1 | cellecta-human-rna-xcr-umi-drivermap-air | CDR3 | hsa | PPSV23+Td_Immunized |
| Immunized_Day8_2 | Immunized_Day8_2 | cellecta-human-rna-xcr-umi-drivermap-air | CDR3 | hsa | PPSV23+Td_Immunized |
Sequencing and Alignment Quality
This section contains an overview of the quality of read sequencing and alignment. The sequencing section outlines the total number of sequences in each sample, as well as FastQC metrics which are relevant to DriverMap AIR libraries. The alignment section outlines the alignment of the samples to the reference genome. Highlighted in this section are successful alignments, non-TCR/IG alignments, reads with no V and/or J hits, reads with no CDR3 regions, reads with no barcodes, etc. Lastly, the reads per UMI filter section shows the histogram generated by MiXCR which shows the number of reads per UMI. A cut-off threshold marked in a red dotted line is used to filter out erroneous UMI prior to downstream analysis.
fastqc is used to determine the quality of the sequences. A variety of metrics are curated by the software to determine whether the samples are suited for downstream bioinformatic analysis. Each metric is deemed to PASS, WARN or FAIL indicating the success, requirement for some concern, or that the sample needs to be evaluated more carefully. Note that the quality metrics were designed for generic purposes. For further explanation on each metric, see the following article (external source):
| sample | pct.gc | tot.seq | seq.length |
|---|---|---|---|
| Control_1_S20_R1_001 | 58 | 8952881 | 308 |
| Control_1_S20_R2_001 | 57 | 8952881 | 308 |
| Control_2_S21_R1_001 | 57 | 7328409 | 308 |
| Control_2_S21_R2_001 | 57 | 7328409 | 308 |
| Control_3_S28_R1_001 | 58 | 7205548 | 308 |
| Control_3_S28_R2_001 | 57 | 7205548 | 308 |
| Immunized_Day5_1_S24_R1_001 | 57 | 11659613 | 308 |
| Immunized_Day5_1_S24_R2_001 | 57 | 11659613 | 308 |
| Immunized_Day5_2_S31_R1_001 | 57 | 10644001 | 308 |
| Immunized_Day5_2_S31_R2_001 | 57 | 10644001 | 308 |
| Immunized_Day8_1_S25_R1_001 | 58 | 27375362 | 308 |
| Immunized_Day8_1_S25_R2_001 | 57 | 27375362 | 308 |
| Immunized_Day8_2_S32_R1_001 | 57 | 25610902 | 308 |
| Immunized_Day8_2_S32_R2_001 | 57 | 25610902 | 308 |
pct.gc = GC Percentage
tot.seq = Total Number of Reads
seq.length = Sequencing Length (NT)
| sample | nb_problems | module |
|---|---|---|
| Control_1_S20_R1_001 | 1 | Adapter Content |
| Control_1_S20_R2_001 | 1 | Adapter Content |
| Control_2_S21_R1_001 | 1 | Adapter Content |
| Control_2_S21_R2_001 | 1 | Adapter Content |
| Control_3_S28_R1_001 | 1 | Adapter Content |
| Control_3_S28_R2_001 | 1 | Adapter Content |
| Immunized_Day5_1_S24_R1_001 | 1 | Adapter Content |
| Immunized_Day5_1_S24_R2_001 | 1 | Adapter Content |
| Immunized_Day5_2_S31_R1_001 | 1 | Adapter Content |
| Immunized_Day5_2_S31_R2_001 | 1 | Adapter Content |
| Immunized_Day8_1_S25_R1_001 | 1 | Adapter Content |
| Immunized_Day8_1_S25_R2_001 | 1 | Adapter Content |
| Immunized_Day8_2_S32_R1_001 | 1 | Adapter Content |
| Immunized_Day8_2_S32_R2_001 | 1 | Adapter Content |
nb_problems = Number of criteria that failed
module = List of
criteria that failed
| Control_1_S20_R1_001 | Control_1_S20_R2_001 | Control_2_S21_R1_001 | Control_2_S21_R2_001 | Control_3_S28_R1_001 | Control_3_S28_R2_001 | Immunized_Day5_1_S24_R1_001 | Immunized_Day5_1_S24_R2_001 | Immunized_Day5_2_S31_R1_001 | Immunized_Day5_2_S31_R2_001 | Immunized_Day8_1_S25_R1_001 | Immunized_Day8_1_S25_R2_001 | Immunized_Day8_2_S32_R1_001 | Immunized_Day8_2_S32_R2_001 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Basic Statistics | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS |
| Per base sequence quality | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS |
| Per tile sequence quality | WARN | WARN | WARN | WARN | WARN | WARN | WARN | WARN | WARN | WARN | WARN | WARN | WARN | WARN |
| Per sequence quality scores | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS |
| Per base N content | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS |
| Sequence Length Distribution | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS | PASS |
| Adapter Content | FAIL | FAIL | FAIL | FAIL | FAIL | FAIL | FAIL | FAIL | FAIL | FAIL | FAIL | FAIL | FAIL | FAIL |
| Control_1 | Control_2 | Control_3 | Immunized_Day5_1 | Immunized_Day5_2 | Immunized_Day8_1 | Immunized_Day8_2 | |
|---|---|---|---|---|---|---|---|
| Successfully aligned reads: | OK | OK | OK | OK | OK | OK | OK |
| Off target (non TCR/IG) reads: | OK | OK | OK | OK | OK | OK | OK |
| Reads with no V or J hits: | OK | OK | OK | OK | OK | OK | OK |
| Reads with no barcode: | OK | OK | OK | OK | OK | OK | OK |
| Overlapped paired-end reads: | OK | OK | OK | OK | OK | OK | OK |
| Alignments that do not cover VDJRegion: | NA | NA | NA | NA | NA | NA | NA |
| Tag groups that do not cover VDJRegion: | NA | NA | NA | NA | NA | NA | NA |
| Barcode collisions in clonotype assembly: | OK | OK | OK | OK | OK | ALERT | ALERT |
| Unassigned alignments in clonotype assembly: | OK | OK | OK | OK | OK | OK | OK |
| Reads used in clonotypes: | OK | OK | OK | OK | OK | WARN | WARN |
| Alignments dropped due to low sequence quality: | OK | OK | OK | OK | OK | OK | OK |
| Alignments clustered in PCR error correction: | NA | NA | NA | NA | NA | NA | NA |
| Clonotypes clustered in PCR error correction: | NA | NA | NA | NA | NA | NA | NA |
| Clones dropped in post-filtering: | OK | OK | OK | OK | OK | OK | OK |
| Alignments dropped in clones post-filtering: | OK | OK | OK | OK | OK | OK | OK |
| Reads dropped in tags error correction and filtering: | OK | OK | OK | OK | OK | WARN | ALERT |
| UMIs artificial diversity eliminated: | OK | OK | WARN | OK | OK | OK | OK |
| Reads dropped in UMI error correction and whitelist: | OK | OK | OK | OK | OK | OK | OK |
| Reads dropped in tags filtering: | OK | OK | OK | OK | OK | WARN | ALERT |
| Control_1 | Control_2 | Control_3 | Immunized_Day5_1 | Immunized_Day5_2 | Immunized_Day8_1 | Immunized_Day8_2 | |
|---|---|---|---|---|---|---|---|
| Successfully aligned reads: | 99.15% | 99.01% | 99.0% | 99.21% | 99.22% | 99.55% | 99.56% |
| Off target (non TCR/IG) reads: | 0.11% | 0.12% | 0.11% | 0.11% | 0.1% | 0.11% | 0.1% |
| Reads with no V or J hits: | 0.73% | 0.86% | 0.88% | 0.67% | 0.68% | 0.33% | 0.33% |
| Reads with no barcode: | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% |
| Overlapped paired-end reads: | 99.5% | 99.55% | 99.51% | 99.51% | 99.52% | 99.47% | 99.47% |
| Alignments that do not cover VDJRegion: | NA | NA | NA | NA | NA | NA | NA |
| Tag groups that do not cover VDJRegion: | NA | NA | NA | NA | NA | NA | NA |
| Barcode collisions in clonotype assembly: | 0.28% | 0.28% | 0.24% | 0.6% | 0.72% | 14.98% | 15.81% |
| Unassigned alignments in clonotype assembly: | 0.45% | 0.41% | 0.44% | 0.53% | 0.52% | 2.6% | 2.66% |
| Reads used in clonotypes: | 97.59% | 97.3% | 97.32% | 97.4% | 96.81% | 87.79% | 85.0% |
| Alignments dropped due to low sequence quality: | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% |
| Alignments clustered in PCR error correction: | NA | NA | NA | NA | NA | NA | NA |
| Clonotypes clustered in PCR error correction: | NA | NA | NA | NA | NA | NA | NA |
| Clones dropped in post-filtering: | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% |
| Alignments dropped in clones post-filtering: | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% | 0.0% |
| Reads dropped in tags error correction and filtering: | 0.74% | 0.92% | 0.86% | 0.96% | 1.56% | 9.19% | 11.0% |
| UMIs artificial diversity eliminated: | 28.45% | 26.29% | 31.44% | 25.36% | 21.65% | 8.1% | 7.81% |
| Reads dropped in UMI error correction and whitelist: | 0.27% | 0.28% | 0.26% | 0.25% | 0.3% | 0.53% | 0.59% |
| Reads dropped in tags filtering: | 0.47% | 0.64% | 0.59% | 0.71% | 1.26% | 8.66% | 10.41% |
MiXCR automatically sets a filter to identify UMIs that attain a
sufficient number of reads to be called real. Shown below are the number
of samples with a given number of reads per UMI. In the dotted red line
is the filter applied for that particular sample.
Sample: Control_1